View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_high_40 (Length: 251)
Name: NF10151A_high_40
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_high_40 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 35557909 - 35558130
Alignment:
Q |
22 |
aaaagaatcaataataatcaagtaaaattttcaatatcagtcagatccaatagagattgtagcactagaaatgctaccatgactactactatcacaaaga |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35557909 |
aaaagaatcaataataatcaagtaaaattttcaatatcagtcagatccaatagagattgtagcactagaaatgctaccatgactactactatcacaaaga |
35558008 |
T |
 |
Q |
122 |
gtgaaagcacgttccaaattagccacaatatcacttattgttggcctatcttttccttccaaatgcacacaatgcattgcagtatatgacacaagctcca |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35558009 |
gtgaaagcacgttccaaattagccacaatatcacttattgttggtctatcttttccttccaaatgcacacaatgcattgcagtatatgacacaagctcca |
35558108 |
T |
 |
Q |
222 |
ctgcttctgtttcattcatctc |
243 |
Q |
|
|
|||||||||||||||||||||| |
|
|
T |
35558109 |
ctgcttctgtttcattcatctc |
35558130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 145 - 217
Target Start/End: Original strand, 35555322 - 35555394
Alignment:
Q |
145 |
cacaatatcacttattgttggcctatcttttccttccaaatgcacacaatgcattgcagtatatgacacaagc |
217 |
Q |
|
|
|||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35555322 |
cacaatgtcacttattgttggtctatcttttccttccaaatgcacacaatgcattgcagtatatgacacaagc |
35555394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 95
Target Start/End: Original strand, 35555251 - 35555320
Alignment:
Q |
24 |
aagaatcaataataatcaagtaaaattttcaatatcagtcagatccaatagagattgtagcactagaaatgc |
95 |
Q |
|
|
||||||| |||| ||||| ||| ||| ||||| ||||||||||||||| ||||||||| ||| |||||||| |
|
|
T |
35555251 |
aagaatcgataaaaatca--taacattatcaatgtcagtcagatccaatcgagattgtaacacaagaaatgc |
35555320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 133 - 195
Target Start/End: Original strand, 31754808 - 31754870
Alignment:
Q |
133 |
ttccaaattagccacaatatcacttattgttggcctatcttttccttccaaatgcacacaatg |
195 |
Q |
|
|
|||||||||||||||||||||| || ||||| |||||||| |||||||||| ||||||||| |
|
|
T |
31754808 |
ttccaaattagccacaatatcagccatagttggtctatctttcccttccaaattcacacaatg |
31754870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 207
Target Start/End: Original strand, 25739918 - 25739961
Alignment:
Q |
164 |
ggcctatcttttccttccaaatgcacacaatgcattgcagtata |
207 |
Q |
|
|
||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
T |
25739918 |
ggcctttcttttccttccaaattcacacaatgcatagcagtata |
25739961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University