View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10151A_high_41 (Length: 248)

Name: NF10151A_high_41
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10151A_high_41
NF10151A_high_41
[»] chr7 (1 HSPs)
chr7 (5-78)||(36904145-36904218)


Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 5 - 78
Target Start/End: Original strand, 36904145 - 36904218
Alignment:
5 ggccttataaggcaaactaaagcgattgttctaataaattttgaagcaaaccattatactaagaaccctaaaaa 78  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
36904145 ggccttataaggcaaactaaagcgattgttctaataaattttgaagcaaaccattatactaagaaccccaaaaa 36904218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University