View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_high_41 (Length: 248)
Name: NF10151A_high_41
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 5 - 78
Target Start/End: Original strand, 36904145 - 36904218
Alignment:
| Q |
5 |
ggccttataaggcaaactaaagcgattgttctaataaattttgaagcaaaccattatactaagaaccctaaaaa |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36904145 |
ggccttataaggcaaactaaagcgattgttctaataaattttgaagcaaaccattatactaagaaccccaaaaa |
36904218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University