View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_high_46 (Length: 230)
Name: NF10151A_high_46
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_high_46 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 230
Target Start/End: Complemental strand, 53038055 - 53037846
Alignment:
| Q |
13 |
acattgctacatataattcaattaaattttatacttattttgtttaggttatttgtaaagtctagaattatccaacttaattatttttagtttctgcatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
53038055 |
acattgctacatataattcaattaaattttatacttattttgtttaggttatttataaagtctagaattacccaactta----tttttagtttctgcatg |
53037960 |
T |
|
| Q |
113 |
tcaatacatccatgcatggatcacacaatgtcttgataaaaatgcctcttgaatgcatccatatgaacctcttgcaaacaaatagcaaccaacaaagatc |
212 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53037959 |
tcaatacatccatg----gatcacacaatgtcttgataaaaatgcctcttgaatgcatccatatgaacctcttgcaaacaaatagcaaccaacaaagatc |
53037864 |
T |
|
| Q |
213 |
catcatcatcataactag |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
53037863 |
catcatcatcataactag |
53037846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 120 - 221
Target Start/End: Original strand, 39995636 - 39995737
Alignment:
| Q |
120 |
atccatgcatggatcacacaatgtcttgataaaaatgcctcttgaatgcatccatatgaacctcttgcaaacaaatagcaaccaacaaagatccatcatc |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||| || |||||||||| | |||||| | ||||||| |||||||||||| |||||||| |
|
|
| T |
39995636 |
atccatccatggatcacacaatgtcttgataaaaatgcttcttaaagacatccatatggatctcttgtagacaaataataaccaacaaagaaccatcatc |
39995735 |
T |
|
| Q |
220 |
at |
221 |
Q |
| |
|
|| |
|
|
| T |
39995736 |
at |
39995737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University