View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_high_47 (Length: 230)
Name: NF10151A_high_47
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_high_47 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 117 - 224
Target Start/End: Complemental strand, 40471315 - 40471216
Alignment:
| Q |
117 |
ggaatgtgtaagtttataaactggcccgccccccttaatattttagaattaattaattaattaaactcagttaaattgttacttggtcagtaagattggt |
216 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40471315 |
ggaatgtgtaagtttataaactggccc----cccttaatattttagaattaattaattaa----actcagttaaattgttacttggtcagtaagattggt |
40471224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 2 - 65
Target Start/End: Complemental strand, 40471421 - 40471363
Alignment:
| Q |
2 |
aacttaggactgtgtagtttctatggctagcttggattggagaggagatgagagtggtgtgggg |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40471421 |
aacttaggactgtgtagtttctatggctagct-----tggagaggagatgagagtggtgtgggg |
40471363 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University