View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_106 (Length: 286)
Name: NF10151A_low_106
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_106 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 21 - 283
Target Start/End: Complemental strand, 54181218 - 54180956
Alignment:
| Q |
21 |
atcacattcttatttcctaacatgaataatgcaaagcgttttgaagaaatagctactacaccctcaaatttttcttcccatcttgatgaaactatttgtt |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54181218 |
atcacattcttatttcctaacatgaataatgcaaagcgttttgaagaaatagctactacaccctcaaatttttcttcccattttgatgaaactatttgtt |
54181119 |
T |
 |
| Q |
121 |
gtaccactactactaatcaaaacaatgttaccaatattggagccacatatgcacccatagtttcccctcctttgattgaagagaatgtcgatgaagtatt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54181118 |
gtaccactactactaatcaaaacaatgttaccaatattggagccacatatgcacccatagtttcccctcctttgattgaagagaatgtcgatgaagtatt |
54181019 |
T |
 |
| Q |
221 |
tacgaagctgtccccaacaattctcgatccttgtttaggccgatatatttacgtttatgatct |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54181018 |
tacgaagctgtccccaacaattctcgatccttgtttaggccgatatatttacgtttatgatct |
54180956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University