View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_110 (Length: 284)
Name: NF10151A_low_110
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_110 |
 |  |
|
| [»] scaffold0096 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 98 - 264
Target Start/End: Original strand, 32650608 - 32650774
Alignment:
| Q |
98 |
ggaatccaaaggaaaaagtaccagaacgtgaacaatcataatgattaactgaaatcatttcatgaggggtttgtttatatttgtgtaaatatcagaacaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32650608 |
ggaatccaaaggaaaaagtaccagaacgtgaacaatcataatgattaactgaaatcatttcatgaggggtttgtttatatttgtgtaaatatcagaacaa |
32650707 |
T |
 |
| Q |
198 |
ttctgatccatttatcacggcgataatgcaaattaatgaaaggaaagagtaaacgaattgagatgct |
264 |
Q |
| |
|
|||||||||||| |||||||| |||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32650708 |
ttctgatccattcatcacggccataatgaaaataaatgaaaggaaagagtaaacgaattgagatgct |
32650774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 12537303 - 12537407
Alignment:
| Q |
1 |
tcataccaaaaatcctgagttgacatcagattttggcaaggacttctcaaatgtgtggtaaaacttccttggaagaaagta---aacatcaggggcgtta |
97 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
12537303 |
tcataccaaaaaacctgagttgacatcagattttggcaactacttctcaaatgtgtggtaaaacttccttggaagaaagtaaacaacatcaggggcgtta |
12537402 |
T |
 |
| Q |
98 |
ggaat |
102 |
Q |
| |
|
||||| |
|
|
| T |
12537403 |
ggaat |
12537407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0096 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: scaffold0096
Description:
Target: scaffold0096; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 29279 - 29175
Alignment:
| Q |
1 |
tcataccaaaaatcctgagttgacatcagattttggcaaggacttctcaaatgtgtggtaaaacttccttggaagaaagta---aacatcaggggcgtta |
97 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
29279 |
tcataccaaaaaacctgagttgacatcagattttggcaacgacttctcaaatgagtggtaaaacttccttggaagaaagtaaacaacatcaagggcgtta |
29180 |
T |
 |
| Q |
98 |
ggaat |
102 |
Q |
| |
|
||||| |
|
|
| T |
29179 |
ggaat |
29175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University