View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_112 (Length: 282)
Name: NF10151A_low_112
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_112 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 25 - 265
Target Start/End: Complemental strand, 40586365 - 40586119
Alignment:
| Q |
25 |
ctccctcttgaatgaatcttttactatatttcttccttttccaggagctgaaaaaatgaatggaagtgctttgttctgtttgtagaatttggcacagaaa |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586365 |
ctccctcttgaatgaatcttttactatatttcttccttttccaggagttgaaaaaatggatggaagtgctttgttctgtttgtagaatttggcacagaaa |
40586266 |
T |
 |
| Q |
125 |
aataatacttttgacttagttattttataatgccagttccacttgctccttatccaactccacctccagctcctgctccagc------tccatatacaac |
218 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40586265 |
aataatacttttgacttagttcttttataatgccagttccacttgctccttatccaactccacctccagctcctgctccagctccagctccatatacaac |
40586166 |
T |
 |
| Q |
219 |
acctccaacaaatggtatcttaacctttctttttctctgtgcttgat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40586165 |
acctccaacaaatggtatcttaacctttctttttctctgtgcttgat |
40586119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University