View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_136 (Length: 261)
Name: NF10151A_low_136
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_low_136 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 176 - 256
Target Start/End: Original strand, 50422786 - 50422866
Alignment:
Q |
176 |
accattagtctcttctatatatgcttatttttagcttatnnnnnnntcgctagatcataaaattttgttcgaacaccaaac |
256 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
T |
50422786 |
accattagtctcttctatatatgcttatttttagcttataaaaaaatcgctagatcataaaattttgttcgaacacaaaac |
50422866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University