View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_145 (Length: 254)
Name: NF10151A_low_145
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_145 |
 | |
|
| [»] scaffold0076 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0076 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 57102 - 56882
Alignment:
| Q |
1 |
gattgacttgtttggagatgttggttagtctatgtgattcttgttttaaagactaagaattatggtatgtttataggagcactgatgaggtgaaatattg |
100 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||| ||||| |||||| |||| ||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
57102 |
gattggcttgtttggagatgttagttagtctatgtgattcttgtgttaaa-actaagggttatagtatgtttataggagcaatgatgaggtaaaatattg |
57004 |
T |
|
| Q |
101 |
tgtagaggatagataatcacatgtgtctatgtgattcttgttcctcatattatctataatatcaatgacaaaacttgtcatgttagttaaatt----aag |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || | || ||| |
|
|
| T |
57003 |
tgtagagtatagataatcacatgtgtctatgtgattcttgttcctcatattatctataatatcaatgacaaaacttgtcttgttattttatttagaaaag |
56904 |
T |
|
| Q |
197 |
aaaagtagggtatatagtaaaa |
218 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
56903 |
aaaagtagggtatatagtaaaa |
56882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University