View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_151 (Length: 252)
Name: NF10151A_low_151
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_low_151 |
 |  |
|
[»] scaffold0076 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0076 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0076
Description:
Target: scaffold0076; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 57247 - 57291
Alignment:
Q |
8 |
aatcacgataagtggataaaatacaagtgaagatggatccttcat |
52 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
57247 |
aatcacgatatgtggataaaatacaagtgaagatggatccttcat |
57291 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University