View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_152 (Length: 252)
Name: NF10151A_low_152
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_152 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 38567017 - 38566802
Alignment:
| Q |
1 |
aggtgaagttcttatcgatggaactaacaggaaagaattgcaggtcaggtggatcagagggaaaattggtcttgttagccaggagccagtgttgtttgca |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38567017 |
aggtgaagttcttatcgatggaattaacatgaaagaatttcaggtcaggtggatcagagggaaaattggtcttgttagccaggagccagtgttgtttgca |
38566918 |
T |
 |
| Q |
101 |
tccagcattaaggataacatttcatacggtaaagatggagcaacgattgaagaaataagatctgcatctgaacttgcaaacgctgccaaattcattgata |
200 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38566917 |
tccagcattaaggataacatttcatatggtaaagatggagcaacgattgaagagataagatctgcatctgaacttgcaaacgctgccaaattcattgata |
38566818 |
T |
 |
| Q |
201 |
aactgccacaggttct |
216 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
38566817 |
aactgccccaggttct |
38566802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 2 - 216
Target Start/End: Complemental strand, 38525891 - 38525677
Alignment:
| Q |
2 |
ggtgaagttcttatcgatggaactaacaggaaagaattgcaggtcaggtggatcagagggaaaattggtcttgttagccaggagccagtgttgtttgcat |
101 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||||||| | ||| | ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
38525891 |
ggtgaagtacttatcgatggaattaacatgaaagaacttcagcttaggtggatcagagggaaaattggtcttgtcagccaggagccagtgttatttgcat |
38525792 |
T |
 |
| Q |
102 |
ccagcattaaggataacatttcatacggtaaagatggagcaacgattgaagaaataagatctgcatctgaacttgcaaacgctgccaaattcattgataa |
201 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
38525791 |
ccagcattaaggataacattgcatatggtaaagatggagcaacaattgaagaaataagatctgcatccgaacttgcaaacgccgccaaattcattgataa |
38525692 |
T |
 |
| Q |
202 |
actgccacaggttct |
216 |
Q |
| |
|
||| ||||||||||| |
|
|
| T |
38525691 |
acttccacaggttct |
38525677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University