View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_154 (Length: 251)
Name: NF10151A_low_154
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_154 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 553000 - 552763
Alignment:
| Q |
1 |
taatcttgcatgtgttgatcaatgttgaatctttaatgcaggtgagtgcataatgaacatgtggcataagatgagtgcgtcggaaattattttgtaatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
553000 |
taatcttgcatgtgttgatcaatgttgaatctttaatgcaggtgagtgcaaaatgaacatgtggcataagatgagtgcgtcggaaatgattttgtaatta |
552901 |
T |
 |
| Q |
101 |
tagggagtatatttggtggtgttagtcgaaaatacttggagaggtacgagacattagaatttggggtattggaggttcaact--aatgaaacgtgtgatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| |
|
|
| T |
552900 |
tagggagtatatttggtggtgttagtcgaaaatacttggagaggtacgagacattagaatttggggtattggaggttcaactacaatgaaacatgtgatt |
552801 |
T |
 |
| Q |
199 |
tattttgttgtgtggttattgcaattgttaaacattat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
552800 |
tattttgttgtgtggttattgcaattgttaaacattat |
552763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University