View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_156 (Length: 250)
Name: NF10151A_low_156
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_156 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 36904165 - 36904072
Alignment:
| Q |
1 |
tttagtttgccttataaggccattatatttcagtatatgttcttgttttctttttcttttactaaatgagtatacgatcttctatgatgtccat |
94 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
36904165 |
tttagtttgccttataaggccgttatatttcagtatatgttcttgttttctttttcttttactaaatgagtatacgatcttctattatttccat |
36904072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 15 - 94
Target Start/End: Original strand, 37073757 - 37073837
Alignment:
| Q |
15 |
taaggccattatatttcagtatatgttcttgttttctt-tttcttttactaaatgagtatacgatcttctatgatgtccat |
94 |
Q |
| |
|
|||||||||||||||| |||| ||||||||| |||||| |||||||||||| ||||| |||| ||||||||| || ||||| |
|
|
| T |
37073757 |
taaggccattatatttgagtagatgttcttgctttcttctttcttttactatatgagcatacaatcttctattatttccat |
37073837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University