View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_167 (Length: 249)
Name: NF10151A_low_167
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_167 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 7617739 - 7617528
Alignment:
| Q |
1 |
gtaattgttatgtgtagctgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617739 |
gtaattgttatgtgtagttgcatataagaaatcaatgatgcatgtgatttcaatgaatgtgtgaagccaatagggtgtgcttttataagcttctgttctg |
7617640 |
T |
|
| Q |
101 |
tctttaaagtgnnnnnnnnnccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgctaattatatttagtttatacttcaaa |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7617639 |
tctttaaagtg--aaaaaaaccggaaagtagcagcgaaattggctttacactatggaaaaacagtgcactttgctaattatatttagtttatacttcaaa |
7617542 |
T |
|
| Q |
201 |
ataaattaactaac |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
7617541 |
ataaattaactaac |
7617528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University