View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_173 (Length: 248)
Name: NF10151A_low_173
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_173 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 248
Target Start/End: Original strand, 6917429 - 6917656
Alignment:
| Q |
21 |
cagttctgcaacaggaaacaggtactatccggagacgagtttgaagccgggagcacttcgctccccatacagaggtcacaactgtccagaaaggcaagtt |
120 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6917429 |
cagttctgcaacagggaacaggtactatccggagacgagtttgaagccgggagcacttcgctccccatacagaggtcacaactgtccagaatggcaagtt |
6917528 |
T |
 |
| Q |
121 |
ccaggccatcaagattgagcgcggcgaggttgattccgaaacatataggttctgattttccttttgcttgttgtttgagcacactcaatataaaatgcta |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917529 |
ccaggccatcaagattgagcgcggcgaggttgatttcgaaacatataggttctgattttccatttgcttgttgtttgagcacactcaatataaaatgcta |
6917628 |
T |
 |
| Q |
221 |
aatgcaccgacttattattcaataataa |
248 |
Q |
| |
|
||||||| |||||||||||||||||||| |
|
|
| T |
6917629 |
aatgcacagacttattattcaataataa |
6917656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University