View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_179 (Length: 246)
Name: NF10151A_low_179
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_179 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 222
Target Start/End: Complemental strand, 2098096 - 2097888
Alignment:
| Q |
14 |
gtttggtgttcccgtgttggtgactttcctggtaatgtaataccacgggttggagataccctaataatggagtatttgttttttaattggaggacgacac |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2098096 |
gtttggtgttcccgtgttggtgactttcctcgtaatgtaataccacgggttggagataccctaataatggagtatttgttttataattggaggacgacac |
2097997 |
T |
 |
| Q |
114 |
agaagtactagtataaaagtacgaaatcatgattgaaaagatacaacagttttaccatcctatcatcattgaggaaatgcaaacacctgaataaatagga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2097996 |
agaagtactagtataaaagtacgaaatcatgaatgaaaagatacaacagttttaccatcctatcatcattgaggaaatgcaaacacctgaaaaaatagga |
2097897 |
T |
 |
| Q |
214 |
ggagaggcg |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
2097896 |
ggagaggcg |
2097888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University