View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_180 (Length: 246)
Name: NF10151A_low_180
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_180 |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 246
Target Start/End: Original strand, 31506658 - 31506892
Alignment:
| Q |
12 |
gacattgctctagctctaaggacaatagtagttccaactggtactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31506658 |
gacattgctctagctctaaggacaatagtatttccaactgggactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
31506757 |
T |
 |
| Q |
112 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31506758 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
31506857 |
T |
 |
| Q |
212 |
cttggctgagtctgccttcgttcataaataagatc |
246 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
31506858 |
cttggctgagtctgctttcattcataaataagatc |
31506892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 34496101 - 34495867
Alignment:
| Q |
12 |
gacattgctctagctctaaggacaatagtagttccaactggtactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34496101 |
gacattgctctagctctaaggacaatagtatttccaactgggactaggtacgatacaatgtactcgtataaagacctaaacaaacgacaagagtggattg |
34496002 |
T |
 |
| Q |
112 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34496001 |
cttaccttcaagctggtgctggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
34495902 |
T |
 |
| Q |
212 |
cttggctgagtctgccttcgttcataaataagatc |
246 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34495901 |
cttggctgagtctgctttcgttcataaataagatc |
34495867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 246
Target Start/End: Complemental strand, 27607648 - 27607414
Alignment:
| Q |
12 |
gacattgctctagctctaaggacaatagtagttccaactggtactaggtacgacacaatgtactcgtataaagacctaaacaaacgccaagagtggattg |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27607648 |
gacatagctctagctctaaggacaatagtatttccaactgggactaggtacgatacaatgtactcgtataaagacctaaacaaacgacaagagtggattg |
27607549 |
T |
 |
| Q |
112 |
cttaccttcaagctggtgccggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
211 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27607548 |
cttaccttcaagctggtgcaggtattgttgccgacagtgaccctgccgatgagcaccaagaatgtcaaaacaaagctgctggtcttgctcgctccatcga |
27607449 |
T |
 |
| Q |
212 |
cttggctgagtctgccttcgttcataaataagatc |
246 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
27607448 |
cttggctgagtctgctttcgttcataaataagatc |
27607414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University