View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_182 (Length: 245)
Name: NF10151A_low_182
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_182 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 58; Significance: 2e-24; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 164 - 221
Target Start/End: Complemental strand, 6557680 - 6557623
Alignment:
| Q |
164 |
tgtacacaggcacatcatatgcagcagtttatatctaataacttccttatgtatggca |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6557680 |
tgtacacaggcacatcatatgcagcagtttatatctaataacttccttatgtatggca |
6557623 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 138
Target Start/End: Complemental strand, 6549003 - 6548945
Alignment:
| Q |
79 |
tagaataagaggtgaaatctccaaatcattattagctttcacaagtgtatcccctaagtt |
138 |
Q |
| |
|
||||||||||| |||||| |||||||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
6549003 |
tagaataagagctgaaatgtccaaatcatta-tagcttgcacaagtgtatcccgtaagtt |
6548945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 134
Target Start/End: Complemental strand, 6797781 - 6797722
Alignment:
| Q |
76 |
atttagaataagaggtgaaatctccaaatcatt-attagctttcacaagtgtatccccta |
134 |
Q |
| |
|
||||||||| ||| |||||||||||||||||| |||||||| |||||||||||| |||| |
|
|
| T |
6797781 |
atttagaatgtgagatgaaatctccaaatcattaattagcttgcacaagtgtatcaccta |
6797722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 75 - 124
Target Start/End: Complemental strand, 31981825 - 31981775
Alignment:
| Q |
75 |
gatttagaataagaggtgaaatct-ccaaatcattattagctttcacaagt |
124 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
31981825 |
gatttagaataagaggtgaaatgtaccaaatcattattagctttcacaagt |
31981775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 149 - 190
Target Start/End: Complemental strand, 31981775 - 31981734
Alignment:
| Q |
149 |
tatcaaaccgttttgtgtacacaggcacatcatatgcagcag |
190 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31981775 |
tatcaaactattttgtgtacacaggcacatcatatgcagcag |
31981734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 138
Target Start/End: Original strand, 42151269 - 42151329
Alignment:
| Q |
78 |
ttagaataagaggtgaaatctccaaatcattattagctttcacaagtgtatcccctaagtt |
138 |
Q |
| |
|
||||||| | || |||||||||||||| ||||||| ||| ||||| |||||| |||||||| |
|
|
| T |
42151269 |
ttagaatgaaagatgaaatctccaaattattattaacttgcacaaatgtatcacctaagtt |
42151329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University