View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_19 (Length: 426)
Name: NF10151A_low_19
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 5e-97; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 5e-97
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 40614850 - 40614659
Alignment:
Q |
1 |
ggacatccaagatgtagggcttttgaacccatgggatcaggaaatgagttccttcaccaacagattctggaagagtgtcgtggaattggtcgacaaggac |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
40614850 |
ggacatccaagatgtagggcttttgaacccatgggatcaggaaatgagttccttcaccaacagattctggaagagtgccgtggaattggtcgacaaggac |
40614751 |
T |
 |
Q |
101 |
agaggagtacacagtagttgcagcggcgccgagacccaaagccaagcgtgctttcttggagaggatggatgctattgctttgctgcttatca |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
40614750 |
agaggagtacacagtagttgcagcggcgccgagacccaaagccaagcgagctttcttggagacgatggatgctattgctttgctgcttatca |
40614659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 268 - 426
Target Start/End: Complemental strand, 40614583 - 40614427
Alignment:
Q |
268 |
aataaataaatgtggcgaaacacctgtgacttgtcgaaggggaaaattatagagttgagnnnnnnntaaatgtggccaaaagggtgtgtgccttgtagaa |
367 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||| |
|
|
T |
40614583 |
aataaataaatgtggcgaaacacctgtgacttgtcgaaggggaaaattatagagttgagaaaaaaataaatgtggccaaaagggtgtg--ccttgtagaa |
40614486 |
T |
 |
Q |
368 |
gaggaaaattataaaacctgctactaaaacaagaaattaccctcaaacccaaccgaaat |
426 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40614485 |
gaggaaaattataaaacctgctactaaaacaagaaattaccctcaaacccaaccgaaat |
40614427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 86; E-Value: 6e-41
Query Start/End: Original strand, 268 - 425
Target Start/End: Complemental strand, 40610622 - 40610468
Alignment:
Q |
268 |
aataaataaatgtggcgaaacacctgtgacttgtcgaaggggaaaattatagagttgagnnnnnnntaaatgtggccaaaagggtgtgtgccttgtagaa |
367 |
Q |
|
|
||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||| |||| |||||||||||| ||||||||||||||| |
|
|
T |
40610622 |
aataaataaatgtcgcgaaacacatgtgacttgtcgaaggggaaaattagagagttgagaaaaaaataaacgtggccaaaagg--gtgtgccttgtagaa |
40610525 |
T |
 |
Q |
368 |
gaggaaaattataaaacctgctactaaaacaagaaattaccctcaaacccaaccgaaa |
425 |
Q |
|
|
| ||||||||||| ||||||| ||||||| || ||||||||||||||||||||||||| |
|
|
T |
40610524 |
ggggaaaattatacaacctgccactaaaataa-aaattaccctcaaacccaaccgaaa |
40610468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 40610908 - 40610817
Alignment:
Q |
9 |
aagatgtagggcttttgaacccatgggatcaggaaatgagttccttcaccaacagattctggaagagtgtcgtggaattggtcgacaaggac |
100 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||| |||||| || || ||| ||||||||| |||||||| ||||||| ||||| |
|
|
T |
40610908 |
aagatgtagggcttttgaacccatgggatcttgaaatgaattcctttgccgacggatctgggaagagtgccgtggaatcggtcgacgaggac |
40610817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 144 - 189
Target Start/End: Complemental strand, 40610743 - 40610698
Alignment:
Q |
144 |
aagcgtgctttcttggagaggatggatgctattgctttgctgctta |
189 |
Q |
|
|
||||||||||||||| ||||| |||||||| |||||| |||||||| |
|
|
T |
40610743 |
aagcgtgctttcttgaagaggttggatgcttttgcttggctgctta |
40610698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 9 - 67
Target Start/End: Original strand, 1385170 - 1385228
Alignment:
Q |
9 |
aagatgtagggcttttgaacccatgggatcaggaaatgagttccttcaccaacagattc |
67 |
Q |
|
|
|||| ||| |||||||||||||||||||| |||||||||||||||||||| || ||||| |
|
|
T |
1385170 |
aagacgtaaggcttttgaacccatgggatgaggaaatgagttccttcaccgactgattc |
1385228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 9 - 58
Target Start/End: Complemental strand, 18133313 - 18133264
Alignment:
Q |
9 |
aagatgtagggcttttgaacccatgggatcaggaaatgagttccttcacc |
58 |
Q |
|
|
|||||||| |||||||||||||||||||| |||||||| ||||||||||| |
|
|
T |
18133313 |
aagatgtaaggcttttgaacccatgggatgaggaaatgggttccttcacc |
18133264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University