View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_192 (Length: 242)
Name: NF10151A_low_192
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_192 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 38224712 - 38224922
Alignment:
| Q |
13 |
aatatcaagactaaaggaaacaatacctggaccttagaatatggtaaattgttacacctctgaagtatgaatttgttctggctagcaaaattctatttat |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38224712 |
aatatcaagactaaaggaaacaatacctggaccttagactatggtaaattgttccacctctgaagtatgaatttgttctggctagcaaaattctatttat |
38224811 |
T |
|
| Q |
113 |
agttatatacgtgtgtataaatttgagggaggacccaccactaaaccgaaagtgggatctgacacaatttctgaggtgttcagcatccattatttttcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38224812 |
agttatatacgtgtgtataaatttgagggaggacccaccactaaaccgaaagtgggatctgacacaatttctgaggtgttcagcatccattatttttcaa |
38224911 |
T |
|
| Q |
213 |
ttgctattagt |
223 |
Q |
| |
|
|||| |||||| |
|
|
| T |
38224912 |
ttgcgattagt |
38224922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University