View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_197 (Length: 241)
Name: NF10151A_low_197
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_197 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 26 - 222
Target Start/End: Original strand, 38483684 - 38483881
Alignment:
| Q |
26 |
tattattggagtaagaggtgttttgaaaaattgaaatggcctattgatatcgggagtagttttttcgatggaaatcgtgttgggaagacaggttttgttg |
125 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38483684 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatggaaatcgtgttgggaagacgggttttgttg |
38483783 |
T |
|
| Q |
126 |
aacggaggtcgttttggaatttg-ttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
222 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483784 |
aacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
38483881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 103 - 196
Target Start/End: Original strand, 30118163 - 30118257
Alignment:
| Q |
103 |
tgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtta-ggagttttgataggctttgggtgatgttgattttgtttcttcaag |
196 |
Q |
| |
|
|||||| ||||| || |||||||| | ||| |||||||||||| |||| |||||||||| ||||||||| | |||||| | ||||||||||||| |
|
|
| T |
30118163 |
tgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgttgtttcttcaag |
30118257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University