View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_20 (Length: 424)
Name: NF10151A_low_20
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 119; Significance: 1e-60; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 13 - 154
Target Start/End: Original strand, 22536697 - 22536839
Alignment:
| Q |
13 |
aaatgaaaacatccaaa-ttttaaactatgccattgataaataaatatagggaaaggatgatgatcgtgtctttatgaactagttaagaaaactaaaata |
111 |
Q |
| |
|
|||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22536697 |
aaatgaaaacatcccaagttttaaaatatgccattgataaataaatatagggaaaggatgatgatcgtgtctttatgaacttgttaagaaaactaaaata |
22536796 |
T |
 |
| Q |
112 |
gaaatattatcttggaaaaattatgaagaaggatatattaaac |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22536797 |
gaaatattatcttggaaaaattataaagaaggatatattaaac |
22536839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 256 - 349
Target Start/End: Original strand, 22536941 - 22537035
Alignment:
| Q |
256 |
catcacataatctagatcaacttcttagttgcttggttgatcatctcgaggtttgctcattttcacgattt-attttttaaagagctataatcac |
349 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| | |||||||| ||| |||||||| |
|
|
| T |
22536941 |
catcacataatctagatcaacttcttaattgcttggttgataatctcgaggtttgctcattttcacgatttaactttttaaaaagccataatcac |
22537035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 342 - 410
Target Start/End: Original strand, 22600345 - 22600413
Alignment:
| Q |
342 |
ataatcacatgttcttttcatccttgaaagactataccacaatcacatgttagtgctcaacctaccgac |
410 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
22600345 |
ataatcacatgttcttttcatccttggaagactacaccacaatcacatgttagtgctctacctaccgac |
22600413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University