View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_206 (Length: 237)
Name: NF10151A_low_206
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_206 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 22 - 216
Target Start/End: Complemental strand, 3429197 - 3429003
Alignment:
| Q |
22 |
accaacattcttggctacccctgtagttttgtccatcattgacaaagatattgacaaccttgtacttgttccaactacttccacttcacaagaaaatgaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429197 |
accaacattcttggctacccctgtagttttttccatcattgacaaagatattgacaaccttgtacttgttccaactacttccacttcacaagaaaatgaa |
3429098 |
T |
 |
| Q |
122 |
ggttcttgttcttcacaacataggcagtgattgtgtttcactagctagttggttagtaaaatcatgtggtagatactagtggtaggtgttagtat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3429097 |
ggttcttgttcttcacaacataggcagtgattgtgtttcactagctagttggttagtaaaatcatgtggtagatactagtggtaggtgttagtat |
3429003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 23 - 193
Target Start/End: Complemental strand, 3425717 - 3425544
Alignment:
| Q |
23 |
ccaacattcttggctacccctgtagttttgtccatcattgacaaagatattgacaaccttgtacttgttccaactacttccacttcacaagaaaatga-- |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3425717 |
ccaacattcttggctacccctgtagttttgtccatcattaacaatgaaattgacaaccttgtacttgttccagctacttccacttcacaagaaaatgaag |
3425618 |
T |
 |
| Q |
121 |
-aggttcttgttcttcacaacataggcagtgattgtgtttcactagctagttggttagtaaaatcatgtggtag |
193 |
Q |
| |
|
||||||||| |||||||||||||| || ||||||||||||| || |||||| ||| ||||| ||||||||||| |
|
|
| T |
3425617 |
taggttcttgctcttcacaacatagacaatgattgtgtttcattacctagtttgttggtaaagtcatgtggtag |
3425544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University