View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_207 (Length: 237)
Name: NF10151A_low_207
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_207 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 37 - 178
Target Start/End: Original strand, 12045067 - 12045208
Alignment:
| Q |
37 |
tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12045067 |
tacaacttgggaggaggttgataaaggtgtaaatcacttccaccgtgacggaataacgctattgtgctttttggttgagatctaggttggtgtcactcac |
12045166 |
T |
 |
| Q |
137 |
aacatttgttctattaatttttattttggtgatatttgtcca |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12045167 |
aacatttgttctattaatttttattttggcgatatttgtcca |
12045208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 207 - 237
Target Start/End: Original strand, 12045207 - 12045237
Alignment:
| Q |
207 |
cactgttcctccctctcatctcatgtgcttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12045207 |
cactgttcctccctctcatctcatgtgcttc |
12045237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University