View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_214 (Length: 235)
Name: NF10151A_low_214
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_214 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 59 - 201
Target Start/End: Original strand, 44442733 - 44442877
Alignment:
| Q |
59 |
aaacattaatataagtaaaataatgcagtggatactcgacatgt----aaccaacggaagaatttgtgggtctattctaatagactttatatatgcatct |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44442733 |
aaacattaatataagtaaaataatgcagtggatactcgacatgtaaccaaccaacggaagaatttgtgggtctattctaatagactt--tatatgcatct |
44442830 |
T |
 |
| Q |
155 |
atcatacacctttaaagcttcggtctttagggacaaaaaacttacca |
201 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44442831 |
atcattcacctctaaagcttcggtctttagggacaaaaaacttacca |
44442877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 4 - 33
Target Start/End: Original strand, 44442681 - 44442710
Alignment:
| Q |
4 |
acatatactatattgcaatagattttgtag |
33 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
44442681 |
acatatactatattgcaatagattttgtag |
44442710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University