View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10151A_low_223 (Length: 230)

Name: NF10151A_low_223
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10151A_low_223
NF10151A_low_223
[»] chr3 (2 HSPs)
chr3 (117-224)||(40471216-40471315)
chr3 (2-65)||(40471363-40471421)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 117 - 224
Target Start/End: Complemental strand, 40471315 - 40471216
Alignment:
117 ggaatgtgtaagtttataaactggcccgccccccttaatattttagaattaattaattaattaaactcagttaaattgttacttggtcagtaagattggt 216  Q
    |||||||||||||||||||||||||||    |||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||    
40471315 ggaatgtgtaagtttataaactggccc----cccttaatattttagaattaattaattaa----actcagttaaattgttacttggtcagtaagattggt 40471224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 2 - 65
Target Start/End: Complemental strand, 40471421 - 40471363
Alignment:
2 aacttaggactgtgtagtttctatggctagcttggattggagaggagatgagagtggtgtgggg 65  Q
    ||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||    
40471421 aacttaggactgtgtagtttctatggctagct-----tggagaggagatgagagtggtgtgggg 40471363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University