View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_229 (Length: 230)
Name: NF10151A_low_229
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_229 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 10 - 230
Target Start/End: Complemental strand, 1045813 - 1045608
Alignment:
| Q |
10 |
ataagttatagccacaattcaagtcatatcaactccttaaacaaactacttttccattttctttaaattttagcaaaaatttcagtcacacacacagaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
1045813 |
ataagttatagccacaattcaagtcatatcaactccttaaacaaactacttttccattttctttaaattttaacaaaaatttcagtcaca--cacagaat |
1045716 |
T |
 |
| Q |
110 |
gtttgccaaaaataacaaataacaagataaattgaaaaaattaggagcacaaaacgtgattacaatgagttatttattatacttgttaatcgaatagatt |
209 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1045715 |
gtttgccaaaaataacagataacaagataaattgaaaaaattaggagc-------------acaatgagttatttattatacttgttaatcgaatagatt |
1045629 |
T |
 |
| Q |
210 |
caaacagtgaagaaaagatcg |
230 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
1045628 |
caaacagtgaagaaaagatcg |
1045608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University