View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_253 (Length: 225)
Name: NF10151A_low_253
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_253 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 24 - 205
Target Start/End: Complemental strand, 49484365 - 49484184
Alignment:
| Q |
24 |
ggatggggatatgtttgaagttgactacgatgttgcacttatgtcaaaagcaattgaggatgctattgagacggatcctactggtgatgttaatcgtatt |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
49484365 |
ggatggggatatgtttgaagttgactacgatgttgcacttatgtcaaaaacaattgaggatgctattgagacagatcctactggtgatgttaattgtatt |
49484266 |
T |
 |
| Q |
124 |
tctctttctttagtgagtagcaaaatattggccatggtcattgaatactgcaagaagcacaagaacgcacaaatgtcagatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49484265 |
tctctttctttagtgagtagcaaaatattggccatggtcattgaatactgcaagaagcacaagaacgcacaaatgtcagatg |
49484184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 183
Target Start/End: Original strand, 55072199 - 55072247
Alignment:
| Q |
135 |
agtgagtagcaaaatattggccatggtcattgaatactgcaagaagcac |
183 |
Q |
| |
|
||||| ||||||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
55072199 |
agtgaatagcaaaatgttgagcatggtcgttgaatactgcaagaagcac |
55072247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University