View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_26 (Length: 417)
Name: NF10151A_low_26
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-131; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 152 - 405
Target Start/End: Original strand, 4769629 - 4769882
Alignment:
| Q |
152 |
taatcgattaaatctcgatccaataccttcccaagtgtatgagccaaagcagcaccagcaataccagctccaacaatgatgacatcagcatcaccgttaa |
251 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4769629 |
taatcgattaaatctcgatacaataccttcccaagtgtatgagccaaagcagcaccagcaataccagctccaacaatgataacatcagcatcaccgttaa |
4769728 |
T |
 |
| Q |
252 |
gtttctccgatttaatttcaccggcatcagtactcgtcacgctatcctcacgctgatttaccttctcattcacatcataattcttcttcccggtgaaaat |
351 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4769729 |
gtttgtccgatttaatttcaccggcatcagtactcgtcacgctatcctcacgctgatttaccttctcattcacatcataattcttcttcccggcgaaaat |
4769828 |
T |
 |
| Q |
352 |
caaattgtataacgcaaatagactcaaaacagagcttaaaatccaaccgatatt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4769829 |
caaattgtataacgcaaatagactcaaaacagagcttaaaatccaaccgatatt |
4769882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 24 - 68
Target Start/End: Original strand, 4769499 - 4769543
Alignment:
| Q |
24 |
tttgctatatcaactttctctattcaccacaactaacttttcacg |
68 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4769499 |
tttgctatatcaactttctttattcaccacaactaacttttcacg |
4769543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University