View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_263 (Length: 220)
Name: NF10151A_low_263
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_263 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 50465730 - 50465548
Alignment:
| Q |
19 |
acatcgatcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattacta-------attctttttagccattcacaaaca |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50465730 |
acatcgatcacagaatgtaatgcattatgcatgtacataaaagaatggatatgcaactgtgtattactacttactaattctttttagccattcacaaaca |
50465631 |
T |
 |
| Q |
112 |
agtcaactagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctctct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50465630 |
agtcaactagcacgatcaagtactaactctatacaacattttcaattgtaatcttgattttcttaccccattttctcctctct |
50465548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University