View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_265 (Length: 219)
Name: NF10151A_low_265
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_265 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 22362096 - 22362299
Alignment:
| Q |
19 |
cctcttaagactatggtatattctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaacgcatgaaaaagaaaagatgaataa |
118 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
22362096 |
cctcttaatactatggtatactctgttgcacttggattcacatgtggtgccatcattgatccctaacatacacaatgcatgaaatagaaaagatgaataa |
22362195 |
T |
 |
| Q |
119 |
gaacc---cagcaagatcatggttaaaatatgtaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacaccgatatcaggtattttgag |
215 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22362196 |
gaacccagcagcaatatcatggttaaaatatgtaaggtcttgtttgtttgcataccgcggtgagattgacgtgaaaaacaccgatatcaggtattttgag |
22362295 |
T |
 |
| Q |
216 |
cgga |
219 |
Q |
| |
|
|||| |
|
|
| T |
22362296 |
cgga |
22362299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 82
Target Start/End: Complemental strand, 39814971 - 39814908
Alignment:
| Q |
19 |
cctcttaagactatggtatattctgttgcacttggattcacatgtggtgccatcattgatccct |
82 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||| ||||| |||| |||||| ||||||| |
|
|
| T |
39814971 |
cctcttaagactatgccatactctgttgcccttggatttacatggggtgtcatcatggatccct |
39814908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University