View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_267 (Length: 217)
Name: NF10151A_low_267
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_low_267 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 5 - 204
Target Start/End: Original strand, 30877827 - 30878026
Alignment:
Q |
5 |
atatcataaccttccatttccatagcaaagtgaaaagagaaatgaaaaaggagagttgtttgtggggaccaaacacaggagacaaccttggaaacaatgg |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30877827 |
atatcataaccttccatttccatagcaaagtgaaaagagaaatgaaaaaggagagttgtttgtggggaccaaacacaggagacaaccttggaaacaatgg |
30877926 |
T |
 |
Q |
105 |
aataaggagaggtgtttgttctgtgtcggagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaacaagtgacagtagatgatgatgatg |
204 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30877927 |
aataaggagaggtgtttgttctgtgtcagagttgttttggagtgtgatagtgatgaaaatgacagtgtcagtgaacaagtgacagtagatgatgatgatg |
30878026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University