View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_268 (Length: 217)
Name: NF10151A_low_268
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_268 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 52; Significance: 5e-21; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 24125306 - 24125247
Alignment:
| Q |
1 |
gagtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
24125306 |
gagtgttcacttttcttattttgaaagtttccaaatgttcttttcagttagattgcttat |
24125247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 176 - 217
Target Start/End: Complemental strand, 24124471 - 24124430
Alignment:
| Q |
176 |
ttatcttcacagtttggtatgcaatttatgcatggctacgga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24124471 |
ttatcttcacagtttggtatgcaatttatgcatggctacgga |
24124430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 85 - 131
Target Start/End: Complemental strand, 24124546 - 24124500
Alignment:
| Q |
85 |
tttggcgactcttgtatcatatctcttctttggtttatatatataat |
131 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
24124546 |
tttggcgactcttgtatcgtatctcttctttgttttatatatataat |
24124500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 45163377 - 45163435
Alignment:
| Q |
1 |
gagtgttcacttttcttattttgaaagttttcaaatgttcttttcagttaggttgcttat |
60 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||| ||| | ||||||| |
|
|
| T |
45163377 |
gagtgttcactttacttattttgaaagttttcaaat-ttcttttcaattacgctgcttat |
45163435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University