View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_269 (Length: 216)
Name: NF10151A_low_269
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_269 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 23 - 202
Target Start/End: Complemental strand, 26597859 - 26597680
Alignment:
| Q |
23 |
tactccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597859 |
tactccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaac |
26597760 |
T |
|
| Q |
123 |
tcatccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcatattgttg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597759 |
tcatccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcatattgttg |
26597680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University