View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_272 (Length: 215)
Name: NF10151A_low_272
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_272 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 6e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 51 - 191
Target Start/End: Complemental strand, 20489591 - 20489450
Alignment:
| Q |
51 |
tgaaatgaacctaaagaggaagcagtgagatattaatgggccatagtaaatcaatcctagtcaaaagaaattaccctccaagcaattacttttaatttgt |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489591 |
tgaaatgaacctaaagaggaagcagtgagatattaatgggccatagtaaatcaatcctagtcaaaagaaattaccctccaagcaattacttttaatttgt |
20489492 |
T |
 |
| Q |
151 |
t-aaagagtgactttgaagctctcaaaattatggtgggatct |
191 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20489491 |
taaaagagtgactttgaagctctcaaaattatggtgggatct |
20489450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 46
Target Start/End: Complemental strand, 10790446 - 10790407
Alignment:
| Q |
7 |
tatgtaactctactgtttccctttcaatattcatctcagt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10790446 |
tatgtaactctactgtttccctttcaatattcatctcagt |
10790407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University