View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_273 (Length: 214)
Name: NF10151A_low_273
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_273 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 6917710 - 6917921
Alignment:
| Q |
1 |
aagtaattttcgcactatttgatgacttttcttggcacacatgcatgctgtttccacgcctgtgttatggttggttgagaggctatgatgttaacataat |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6917710 |
aagtaatttttgcactatttgatgactgttcttggcacatatgcatgatgtttccacgcctgtgttatggttggttgagaggctatgatgttaacataat |
6917809 |
T |
|
| Q |
101 |
ttgtccactggtgttgaaaagtcaaatggcttatgtcatgagaacaacaaggttacatggtcgtttccaagatcaatggtaaaggttaaaaacttgaagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6917810 |
ttgtccactggtgttgaaaagtcaaatggcttatgtcatgagaacaacaaggttacatggtcatttccaagatcaacggtaaaggttaaaaacttgaagt |
6917909 |
T |
|
| Q |
201 |
aatggtaatttg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6917910 |
aatggtaatttg |
6917921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University