View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_275 (Length: 213)
Name: NF10151A_low_275
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_275 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 6111200 - 6111156
Alignment:
| Q |
1 |
tcaaggtaaatgagttccacttttttactaatatttggcttccat |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111200 |
tcaaggtaaatgagttccacttttttactaatatttggcttccat |
6111156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University