View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_282 (Length: 206)
Name: NF10151A_low_282
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_282 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 15 - 190
Target Start/End: Original strand, 33331664 - 33331839
Alignment:
| Q |
15 |
tttggtgttggggtttgggcaattgttattgtcgctatgagtttgtgttgttcgattgttttgtgatattgtttgggtgtcgttggtagctctttatgag |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33331664 |
tttggtgttggggtttgggcaattgttattgtcgctatgagtttgtgttgttcgattgttttgtgatattgtttgggtgtcgttggtagctctttatgag |
33331763 |
T |
|
| Q |
115 |
ttgaccagtttgacttttagttggggtcttataaatagactttatgtgcatgtgtccctcttttttgaatgttcgg |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33331764 |
ttgaccagtttgacttttagttggggtcttataaacagactttatgtgcatgtgtccctcttttttgaatgttcgg |
33331839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 53 - 112
Target Start/End: Original strand, 20782052 - 20782111
Alignment:
| Q |
53 |
gagtttgtgttgttcgattgttttgtgatattgtttgggtgtcgttggtagctctttatg |
112 |
Q |
| |
|
|||||||| ||||| | ||||||||| | ||||||||||||| ||||||||| ||||||| |
|
|
| T |
20782052 |
gagtttgtattgtttggttgttttgtaaaattgtttgggtgttgttggtagccctttatg |
20782111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University