View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_284 (Length: 205)
Name: NF10151A_low_284
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_284 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 5e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 5e-98
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 49483864 - 49484068
Alignment:
| Q |
1 |
acaacatgttatattctctccaacaaacaaagagccattgaatattaaatgataaacgaaacaggaataaaacttcaggtatattttttagctgaaaatt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49483864 |
acaacatgttatattcgctccaacaaacaaagagccattgaagattaaatgataaacgaaacaggaaataaacttcaggtatattttttagctgaaaatt |
49483963 |
T |
|
| Q |
101 |
tcaagactttactggttttactcttcctgtgtacaaacatctttaatgtcaaataactgggcaatttcacctgctgtctttccttttatcatgtctccta |
200 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49483964 |
tcaagacttcactggttttgctcttcctgtgtacaaacatctttaatgtcaaataactgggcaatttcacctgctgtctttccttttatcatgtctccta |
49484063 |
T |
|
| Q |
201 |
tttta |
205 |
Q |
| |
|
||||| |
|
|
| T |
49484064 |
tttta |
49484068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University