View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_290 (Length: 203)
Name: NF10151A_low_290
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_290 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 76 - 203
Target Start/End: Complemental strand, 55385281 - 55385154
Alignment:
| Q |
76 |
gtattgtatattttcttacaaatagaagtataataattgcaaacattttcttgagccagtttagctggttgcatttccttctgacttcaccttgcatagt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
55385281 |
gtattgtatattttcttacaaatagaagtataataattgcaaacattttcttgagctagtttagctggttgcatttccttctgacttcaccttgaatatt |
55385182 |
T |
 |
| Q |
176 |
tgtgagaacattgctagcagaaagctta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
55385181 |
tgtgagaacattgctagcagaaagctta |
55385154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 6 - 81
Target Start/End: Original strand, 55384981 - 55385056
Alignment:
| Q |
6 |
aatgacatgaccccaacaatatttgacaatcaatattaccgagacattatgatgggaagaggtttgcttggtattg |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55384981 |
aatgacatgaccccaacaatatttgacaatcaatattaccgagacattatgatgggaagaggtttgcttggtattg |
55385056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University