View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_291 (Length: 203)
Name: NF10151A_low_291
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_291 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 203
Target Start/End: Original strand, 55384981 - 55385178
Alignment:
| Q |
6 |
aatgacatgaccccaacaatatttgacaatcaatattaccgagacattatgatgggaagaggtttgcttggtattgactcgagcatttctagagatccac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55384981 |
aatgacatgaccccaacaatatttgacaatcaatattaccgagacattatgatgggaagaggtttgcttggtattgactcgagcatttctagagatccac |
55385080 |
T |
 |
| Q |
106 |
gaactgcacccattgtcatgaggtttgctatggatcagagctacttctttgagaacttctcatctgcatttgttaagctttctgctagcaatgttctc |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55385081 |
gaactgcacccattgtcatgaggtttgctatggatcagagctacttctttgagaacttctcatctgcatttgttaagctttctgctagcaatgttctc |
55385178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University