View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_292 (Length: 202)
Name: NF10151A_low_292
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_292 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 17 - 190
Target Start/End: Original strand, 6111149 - 6111322
Alignment:
| Q |
17 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111149 |
gacatcagatgatagggaggaaaggaaaaccatacctgaagtgactcagcatcagtagtcatcaagttggttatttttccagatgcaaattgttttcgcg |
6111248 |
T |
|
| Q |
117 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111249 |
cttcgtgagtaagccttagagacttgcgaaatactgctgctacctacaaggaaggaaaatggaacaccaaactc |
6111322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University