View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_293 (Length: 201)
Name: NF10151A_low_293
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_293 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 2e-45; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 6111176 - 6111268
Alignment:
| Q |
1 |
aaaaagtggaactcatttaccttgatcttgtgttgaataaactctattaatcacagcagcttctggtggattacttgaagtggatgccatatt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6111176 |
aaaaagtggaactcatttaccttgatcttgtgttgaataaactctattaatcacagcagcttctggtggattacttgaagtggatgccatatt |
6111268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 14 - 90
Target Start/End: Original strand, 6183291 - 6183370
Alignment:
| Q |
14 |
catttaccttgatcttgtgttgaataaactctattaatcacagcagcttc---tggtggattacttgaagtggatgccat |
90 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
6183291 |
catttaccttgatattgtgttgaataaagtctattaatcacatgagcttctagtggtggattacttgaagtggatgccat |
6183370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 57 - 93
Target Start/End: Original strand, 6090227 - 6090263
Alignment:
| Q |
57 |
cagcttctggtggattacttgaagtggatgccatatt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6090227 |
cagcttctggtggattacttgaagtggatgccatatt |
6090263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 13 - 93
Target Start/End: Original strand, 6209748 - 6209828
Alignment:
| Q |
13 |
tcatttaccttgatcttgtgttgaataaactctattaatcacagcagcttctggtggattacttgaagtggatgccatatt |
93 |
Q |
| |
|
|||||||||| ||| |||||||||||||| |||||||| | || | | |||||||||||||||||||||||||||||| |
|
|
| T |
6209748 |
tcatttacctcgatattgtgttgaataaagtctattaaccgcaacttccgatggtggattacttgaagtggatgccatatt |
6209828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University