View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_60 (Length: 335)
Name: NF10151A_low_60
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151A_low_60 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 15 - 329
Target Start/End: Original strand, 44906872 - 44907186
Alignment:
| Q |
15 |
aatacacaaaatgatgttgaaatacgatgcagactgatggagtctacttcggtggtcttattgggcgtgtggcaaataggatcggaggagctcaattcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44906872 |
aatacacaaaatgatgttgaaatacgatgcagactgatggagtctacttcggtggtcttattgggcgtgtggcaaataggatcggaggagctcaattcac |
44906971 |
T |
 |
| Q |
115 |
tttggatggtaaaacatacaaattgccagctaatgatcatgggaacacactccatggtacgttaatattagtatatctaaatttctgataaataatctac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
44906972 |
tttggatggtaaaacatacaaattgccagctaatgatcatgggaacacactccatggtacgttaatatttgtatatctaaatttctgataaataatttac |
44907071 |
T |
 |
| Q |
215 |
atacacacattataaattcatgcaatgatgcattatgtacattttcttattaatcattgatgaaattgcaggtggccagaaagggttcggtgataatgta |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44907072 |
atacacacattataaattcatgcaatgatgcattatgtacattttcttattaatcattgatgaaattgcaggtggccagaaagggttcggtgataatgta |
44907171 |
T |
 |
| Q |
315 |
tggaaagtaaaaatt |
329 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
44907172 |
tggaaagtaaaaatt |
44907186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University