View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151A_low_86 (Length: 303)
Name: NF10151A_low_86
Description: NF10151A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10151A_low_86 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 23 - 196
Target Start/End: Complemental strand, 26597859 - 26597686
Alignment:
Q |
23 |
tactccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaac |
122 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26597859 |
tactccacgccctaacatcatcatctcatactggttttgatgtgtctgtggatgagtagtagttaacaaagctgtcagattccggtgaccggagaaaaac |
26597760 |
T |
 |
Q |
123 |
tcatccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcata |
196 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26597759 |
tcatccgtagccgctgtcggtatagatgggaaatgggttgaccttgttccatttactagctgtcttagatcata |
26597686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 253 - 292
Target Start/End: Complemental strand, 26597617 - 26597578
Alignment:
Q |
253 |
catccatttttcatgtatatatgagaggctagggtatata |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26597617 |
catccatttttcatgtatatatgagaggctagggtatata |
26597578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University