View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_high_24 (Length: 300)
Name: NF10151_high_24
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 287
Target Start/End: Original strand, 10417228 - 10417496
Alignment:
| Q |
16 |
acaaatctgcattatcccttttcttttacttttatcccgtaccaaagtagtaatttatttaaagcaaattcaactcaatattgtgatagtattataataa |
115 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10417228 |
acaaatctgcattgtcccttttcttttacttttatcacgtaccaaagtagtaatttatttaaagcaaattcaactcaatattgtgata---ttataataa |
10417324 |
T |
 |
| Q |
116 |
ctcatgcactgattgattgtttaacaaaaacacttttatcaattgattgctttaagtaaatgaattcgtacctccaccttcatgattgatgaatgctttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10417325 |
ctcatgcactgattgattgtttaacaaaaacacttttatcaattgattgctttaagtaaatgaattcgtacttccaccttcatgattgatgaatgctttc |
10417424 |
T |
 |
| Q |
216 |
ataccgattggaaccttttatctctgataaccaatatctttttgtaagtaattctgatgtaaccttttgttc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10417425 |
ataccgattggaaccttttatctctgatgaccaatatctttttgtaagtaattctgatgtaaccttttgttc |
10417496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University