View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_high_36 (Length: 240)
Name: NF10151_high_36
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_high_36 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 97 - 240
Target Start/End: Original strand, 9592508 - 9592651
Alignment:
| Q |
97 |
gttgttggttcacaatcacaactcacaaacacgcttccacttgcacttttgcccatcaaaagatccatataatcatcaatagtcttgatgacctaataaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9592508 |
gttgttggttcacaatcacaactcacaaacacgcttccacttgcacttttgcccatcaaaagatccatataatcatcaatagtcttgatgacctaataaa |
9592607 |
T |
|
| Q |
197 |
taattcatccataagcttttgtcttgtgtaagttttcaactggt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9592608 |
taattcatccataagcttttgtcttgtgtaagttttcaactggt |
9592651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University