View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_high_40 (Length: 239)
Name: NF10151_high_40
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_high_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 61 - 225
Target Start/End: Original strand, 41734937 - 41735101
Alignment:
| Q |
61 |
ttcatccacgtctgcccctccctaaattcgtcgcagacaatgatgtcatatatctccctttttatatcactttcaatgnnnnnnnataatggcaaagaaa |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41734937 |
ttcatccacgtctgcccctccctaaattcgtcgcagacaatgatgtcatatatctccctttttatatcactttcaatgtatttttataatggcaaagaaa |
41735036 |
T |
 |
| Q |
161 |
ttcatttcattaaaaatttaaaggatcaatggtatgccaacataaaaatgataatatttggcatt |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735037 |
ttcatttcattaaaaatttaaaggatcaatggtatgccaacataaaaatgataatatttggcatt |
41735101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 41734234 - 41734293
Alignment:
| Q |
1 |
actaaattcgaccaaaaaattcacctaatgatnnnnnnnncggatagttgcaaacataattt |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41734234 |
actaaattcgaccaaaaaattcacctaatgat--aaaaaacggatagttgcaaacataattt |
41734293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University