View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_low_39 (Length: 260)
Name: NF10151_low_39
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 19 - 250
Target Start/End: Complemental strand, 37427911 - 37427680
Alignment:
| Q |
19 |
atcacgtagcaaaaattgtccatttcaaaggacaagagctaggactttttgctatatacgatggacacctgggagacagtgtaccgtcatatttgcaaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37427911 |
atcacgtagcaaaaattgtccatttcaaaggacaagagctaggactttttgctatatacgatggacacctgggagacagtgtaccgtcatatttgcaaaa |
37427812 |
T |
 |
| Q |
119 |
gcatctcttttctaatatcttgaaggaagtgagttgttgaatcaaactaaagatattatgtattggttattgcctcacatttgatttcttcggaaaaggg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37427811 |
gcatctcttttctaatatcttgaaggaagtgagttgttgaaacaaactaaagatattatgtattggttattgcctcacatttgatttcttcggaaaaggg |
37427712 |
T |
 |
| Q |
219 |
cttttcttcctttctattttatgttgtctgtg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37427711 |
cttttcttcctttctattttatgttgtctgtg |
37427680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 20 - 153
Target Start/End: Original strand, 1664573 - 1664706
Alignment:
| Q |
20 |
tcacgtagcaaaaattgtccatttcaaaggacaagagctaggactttttgctatatacgatggacacctgggagacagtgtaccgtcatatttgcaaaag |
119 |
Q |
| |
|
|||||| || ||||| ||||| ||||| || | |||| | |||||||||||||||| ||||||||| ||| |||| ||| || | ||||| ||||| |
|
|
| T |
1664573 |
tcacgttgcgaaaatcgtccagttcaacgggcgagagttgggactttttgctatatttgatggacactcgggtgacactgtgcctgcctatttacaaaaa |
1664672 |
T |
 |
| Q |
120 |
catctcttttctaatatcttgaaggaagtgagtt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1664673 |
catctcttttctaatatcttgaaggaagtgagtt |
1664706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University