View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10151_low_41 (Length: 250)
Name: NF10151_low_41
Description: NF10151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10151_low_41 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 34764584 - 34764345
Alignment:
| Q |
11 |
gaagaaaatgggtaaacacaaagaagaagcttagtactcatcattaagtactttttctttagttgttcgaataatcgatttttgaaaatttgagttttgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34764584 |
gaagaaaatgggtaaacacaaagaagaagcttagtactcatcattaagtgctttttctttagttgttcgaataatcgatttttgaaaatttgagttttgt |
34764485 |
T |
 |
| Q |
111 |
gcttgttatatataaaattgacttgagtcaacaaacagaaaccaaacacatcactaaatgggttcaggaagcagaagctactcagcgaatcctcaagatt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34764484 |
gcttgttatatataaaattgacttgagtcaacaaacagaaaccaaacacatcactaaatgggttcaggaagcagaagctactcagcgaatcctcaagatt |
34764385 |
T |
 |
| Q |
211 |
acaagcttctagaagaagttggttacggtgcaagcgcaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34764384 |
acaagcttctagaagaagttggttacggtgcaagcgcaac |
34764345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University